site stats

Psin4-ef1a-lmo2-ires-puro

Web020 3393 8531 EUR . Euro; British Pound US Dollar Login or Sign Up; 0 WebpSIN4-EF1a-LMO2-IRES-Puro Catalog number PVT20946 Supplier Lifescience Market Price 382.34 USD Size Gentaur supplies 2ug of lyophilized SIN4-EF1a-LMO2-IRES-Puro Plasmid …

Lentiviral Vector Psin4 Ef1a Lmo2 Ires Puro Addgene inc Bioz

WebElectrical connection. Connection. Connector: 1 x M12; coding: A; Contacts: gold-plated. ifm efector, inc. • 1100 Atwater Drive • Malvern • PA 19355 — We reserve the right to make … WebPN-010-RBR14-KFPKG/US/3D /V. For applications in hazardous areas. With switching output and analog output. Clearly visible numerical display. Robust stainless steel housing for … pentegra white plains new york https://alistsecurityinc.com

PN5004 - Pressure sensor with display - ifm

WebpSIN4-EF1a-LMO2-IRES-Puro 8044 bp 400 800 1200 1600 2000 2400 2800 3200 3600 4000 4400 4800 5200 5600 6000 6400 6800 7200 7600 8000 3' LTR HIV-1 Psi RRE gp41 peptide cPPT/CTS EF-1-alpha promoter Kozak sequence FLAG IRES PuroR 3' LTR (Delta-U3) BGH-rev Kozak sequence AmpR promoter AmpR ori. Plasmid Resuspension Protocol: 1. … WebJan 7, 2024 · LMO2 upregulation due to AR deactivation in cancer-associated fibroblasts induces non-cell-autonomous growth of prostate cancer after androgen deprivation. ... EF1a: sequencing_primer_3: ACACCGGCCTTATTCCAA: sequencing_primer_5: TCAAGCCTCAGACAGTGGTTC: site_3_destroyed ... pLV-CDH5-mCitrine-IRES-puro … WebpSIN4-EF1a-LMO2-IRES-Puro . Close You have no items in your shopping cart. pentek big clear 20

Addgene: pSIN4-EF1a-LMO2-IRES-Puro Sequences

Category:pLV-hTERT-IRES-hygro Addgene 85140 product information

Tags:Psin4-ef1a-lmo2-ires-puro

Psin4-ef1a-lmo2-ires-puro

LMO2 activation by deacetylation is indispensable for …

WebLOCUS Exported 8044 bp ds-DNA circular SYN 12-MAY-2024 DEFINITION lentiviral vector for LMO2. ACCESSION . VERSION . KEYWORDS pSIN4-EF1a-LMO2-IRES-Puro SOURCE synthetic DNA constru WebSep 26, 2008 · pLVX-IRES-Puro Vector Map and Multiple Cloning Site (MCS). Description. pLVX-IRES-Puro is an HIV-1-based, lentiviral expression vector that allows the simultaneous . expression of your protein of interest and puromycin resistance (Puro. r) in virtually any mammalian cell type, including primary cells. The vector expresses your protein of ...

Psin4-ef1a-lmo2-ires-puro

Did you know?

WebpSIN4-EF1a-LMO2-IRES-Puro. catalog : 61064. more info or order : Addgene product webpage. citations: 1. Reference; Elcheva I, Brok Volchanskaya V, Kumar A, Liu P, Lee J, … WebPlasmid form: Freeze-dried powder Storage Condition: -20 Centigrade Bulk order Please contact us: [email protected] Promoter: - Bacterial Resistance (s): Amp Screening: - Growth Strain (s): DH5alpha Culture Medium: LB Temperature: 37 Centigrade Vector Size: 1401bp *Product is for research use only! Write Review

Web(A) C2C12 myoblasts were starved of serum and leucine for 2 hr and then IGF-1 and leucine were added to the medium of some of the cells for 45 min. Puromycin (1uM) was added … WebpSIN4-EF1a-ETV2-IRES-Puro Sequences; Sequencing Result #114108; Sequence Analyzer: pSIN4-EF1a-ETV2-IRES-Puro Download: GenBank File SnapGene File File Help; Map; …

WebpLVX-IRES-Puro Lentiviral vector for bicistronic expression of a gene together with a puromycin resistance marker. Sequence Author: Clontech (TaKaRa) Open in SnapGene Try SnapGene for Free Download Plasmid Download SnapGene Viewer Explore Over 2.7k Plasmids: Viral Expression & Packaging Vectors More Plasmid Sets pSIN4-EF1a-LMO2-IRES-Puro was a gift from Igor Slukvin (Addgene plasmid # 61064 ; http://n2t.net/addgene:61064 ; RRID:Addgene_61064) For your References section: Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators.

WebAug 1, 2000 · Cooperation between the stem cell leukemia (SCL) transcription factor and its nuclear partners LMO1 or LMO2 induces aggressive T cell acute lymphoblastic leukemia when inappropriately expressed...

WebJul 31, 2024 · Europe PMC is an archive of life sciences journal literature. toddler boy tartan trousersWebRESEARCH Open Access Significant improvement of direct reprogramming efficacy of fibroblasts into progenitor endothelial cells by ETV2 and hypoxia toddler boy tap shoes size 7WebPrepare solutions with pSIN-EF1α lentiviral expression plasmid containing protein-coding DNA for ETV2, GATA1, GATA2, TAL1 and LMO2 (Table 1). Measure the concentration and purity of plasmid preparations used for lentiviral production by recording UV absorption with a spectrophotometer at 230 nm, 260 nm, and 280 nm. toddler boy tennis shoesWebProduct name pSIN4-EF1a-LMO2-IRES-Puro vector Product Cat. No. V001083 Chemical Formula: Not available Supplier: NovoPro Bioscience Inc. Phone: +86-21-61941042 Fax: 86-216-194-1042 Section 2-Composition / Information on Ingredients Substance/Preparation: Substance Ingredient Name pSIN4-EF1a-LMO2-IRES-Puro vector SARA 313 No Section 3 … toddler boy tartan shirtWebpSIN4-EF1a-LMO2-IRES-Puro Sequences pSIN4-EF1a-LMO2-IRES-Puro Sequences (3) Addgene Sequences: Partial (2) Depositing Scientist Sequences: Full (1) Full Sequences … toddler boy tartan christmas outfitWebThe first control system of its kind specifically designed for user-friendly operation, the PURONet UV Disinfection Control System controls PURO Helo UV germicidal units within … pentek freshpoint ultrafiltration systemWebpCDH-EF1α-MCS-IRES-Puro Cloning and Expression Lentivector With the moderate EF1α promoter upstream of an MCS and an IRES element to co-express a Puro marker, this lentivector is great for stable gene expression Multiple promoter options Multiple marker options—Puro, Neo, Hygro, GFP, or RFP Coordinated co-expression via T2A or IRES pentek conveyor system parts